Available genetic codes¶
from cogent3 import available_codes
available_codes()
Code ID | Name |
---|---|
1 | Standard |
2 | Vertebrate Mitochondrial |
3 | Yeast Mitochondrial |
4 | Mold Mitochondrial; Protozoan Mitochondrial; Coelenterate Mitochondrial; Mycoplasma; Spiroplasma |
5 | Invertebrate Mitochondrial |
6 | Ciliate Nuclear; Dasycladacean Nuclear; Hexamita Nuclear |
9 | Echinoderm Mitochondrial; Flatworm Mitochondrial |
10 | Euplotid Nuclear |
11 | Bacterial, Archaeal and Plant Plastid |
12 | Alternative Yeast Nuclear |
13 | Ascidian Mitochondrial |
14 | Alternative Flatworm Mitochondrial |
15 | Blepharisma Macronuclear |
16 | Chlorophycean Mitochondrial |
21 | Trematode Mitochondrial |
22 | Scenedesmus obliquus Mitochondrial |
23 | Thraustochytrium Mitochondrial |
24 | Rhabdopleuridae Mitochondrial |
25 | Candidate Division SR1 and Gracilibacteria |
26 | Pachysolen tannophilus Nuclear |
27 | Karyorelict Nuclear |
28 | Condylostoma Nuclear |
29 | Mesodinium Nuclear |
30 | Peritrich Nuclear |
31 | Blastocrithidia Nuclear |
32 | Balanophoraceae Plastid |
33 | Cephalodiscidae Mitochondrial |
27 rows x 2 columns
In cases where a cogent3
object method has a gc
argument, you can just use the number under “Code ID” column.
For example:
from cogent3 import load_aligned_seqs
nt_seqs = load_aligned_seqs("data/brca1-bats.fasta", moltype="dna")
nt_seqs[:21]
0 | |
DogFaced | TGTGGCACAAATACTCATGCC |
FlyingFox | ............G........ |
FreeTaile | .........G........... |
LittleBro | .........G........... |
TombBat | ..........G.......... |
5 x 21 dna alignment
We specify the genetic code, and that codons that are incomplete as they contain a gap, are converted to ?
.
aa_seqs = nt_seqs.get_translation(gc=1, incomplete_ok=True)
aa_seqs[:20]
0 | |
DogFaced | CGTNTHANSLQHENSSLLYT |
FlyingFox | ....A..S......-..... |
FreeTaile | ...D...S..........L. |
LittleBro | ...D...S..........L. |
TombBat | ...S...S.V........L. |
5 x 20 protein alignment
Getting a genetic code with get_code()
¶
This function can be used directly to get a genetic code. We will get the code with ID 4.
from cogent3 import get_code
gc = get_code(4)
gc
aa | IUPAC code | codons |
---|---|---|
Alanine | A | GCT,GCC,GCA,GCG |
Cysteine | C | TGT,TGC |
Aspartic Acid | D | GAT,GAC |
Glutamic Acid | E | GAA,GAG |
Phenylalanine | F | TTT,TTC |
Glycine | G | GGT,GGC,GGA,GGG |
Histidine | H | CAT,CAC |
Isoleucine | I | ATT,ATC,ATA |
Lysine | K | AAA,AAG |
Leucine | L | TTA,TTG,CTT,CTC,CTA,CTG |
Methionine | M | ATG |
Asparagine | N | AAT,AAC |
Proline | P | CCT,CCC,CCA,CCG |
Glutamine | Q | CAA,CAG |
Arginine | R | CGT,CGC,CGA,CGG,AGA,AGG |
Serine | S | TCT,TCC,TCA,TCG,AGT,AGC |
Threonine | T | ACT,ACC,ACA,ACG |
Valine | V | GTT,GTC,GTA,GTG |
Tryptophan | W | TGA,TGG |
Tyrosine | Y | TAT,TAC |
STOP | * | TAA,TAG |