Skip to content

Snailz

snail logo

snailz is a synthetic data generator that models a study of snails in the Pacific Northwest which are growing to unusual size as a result of exposure to pollution. The package can generate fully-reproducible datasets of varying sizes and with varying statistical properties, and is intended primarily for classroom use. For example, an instructor can give each learner a unique dataset to analyze, while learners can test their analysis pipelines using datasets they generate themselves. snailz can also be used to teach good software development practices: it is well structured, well tested, and uses modern Python tools.

The Story

Years ago, logging companies dumped toxic waste in a remote region of Vancouver Island. As the containers leaked and the pollution spread, some of the tree snails in the region began growing unusually large. You are collecting and analyzing specimens from affected regions to determine if a mutant gene makes snails more susceptible to the pollution.

snailz generates four related sets of data:

Persons
The scientists conducting the study. Persons are included in the dataset to simulate operator bias, i.e., the tendency for different people to perform experiments in slightly different ways.
Surveys
The locations where specimens are collected. Each survey site is represented as a square grid of pollution readings.
Specimens
The snails collected from the sites. The data records where the snail was found, the date it was collected, its mass, and a short fragment of its genome.
Assays
The chemical analysis of the snails' genomes. One assay is performed for each snail by putting samples of the snail's tissue into some of the small wells in a plastic microplate, while an inert material is placed in other wells as a control. The wells are then treated with chemicals and photographed; the brightness of each well in the photograph shows how reactive the material was. Each assay is stored in two files: a design file showing which wells contain samples and controls, and a readings file with the measured responses. The images that the readings are taken from are also stored.

Usage

  1. pip install snailz (or the equivalent command for your Python environment).
  2. snailz --help to see available commands.
Command Action
data Generate all data files.
params Generate parameter files with default values.

To generate example data in a fresh directory:

# Create and activate Python virtual environment
$ uv venv
$ source .venv/bin/activate

# Install snailz and dependencies
$ uv pip install snailz

# Write default parameter values to ./params.json file
$ snailz params --output params.json

# Generate all output files in ./data directory
$ snailz data --params params.json --output data

Parameters

snailz reads controlling parameters from a JSON file, and can generate a file with default parameter values as a starting point. The parameters, their meanings, and their properties are:

Group Name Purpose Default Notes
overall seed random number generation seed 7493418 non-negative integer
assay baseline assay reading for non-mutant specimens 1.0 non-negative real
degrade reading degradation per day between sample collection and assay 0.05 non-negative real
delay maximum days of delay between sample collection and assay 5 non-negative integer
mutant assay reading for mutant specimens 10.0 non-negative real, greater than baseline
noise random noise for readings 0.1 non-negative real
plate_size number of rows and columns in assay plate 4 non-negative integer
image_noise noise to add to assay images 32 scale is 0-255
survey number number of survey sites 3 non-negative integer
size survey grid size 15 non-negative integer
start_date overall survey start date 2024-03-01 ISO date
max_interval maximum number of days between specimen samples 7 non-negative integer
person locale locale for random name generation et_EE (Estonia) valid ISO locale
number number of persons 5 non-negative integer
specimen length genome length in bases 20 non-negative integer
max_mass maximum unmutated snail mass 10.0 non-negative real
mut_mass_scale scaling factor for mutated snails 2.0 real greater or equal to 1.0
num_mutations maximum number of mutations in genome 5 non-negative integer
spacing space between snail specimens 3.75 non-negative real

Notes:

  1. The pollution values in survey grids are generated by performing a random walk of the grid, adding one to each cell's value each time it is visited. The random walk starts when the polluted region reaches the boundary of the survey grid.

  2. Survey sites are sampled sequentially, i.e., all of the samples from one site are collected before any samples are collected from the next.

  3. Some specimens' grid locations are missing from the final data. Oops.

  4. All snail genomes are the same length, and are generated by mutating the bases at a few randomly-chosen locations. One of those locations and one of the variant bases is selected at random; a snail with that mutant base in that location is a mutant that can grow to unusual size.

  5. The masses of all snails are scaled up by an amount that depends on how polluted their collection location is. This scaling uses a sigmoid function rather than a linear function.

  6. The actual readings for mutated and unmutated snails are randomly generated by adding uniform noise to assay.baseline and assay.mutant. The readings for control wells are just noise.

  7. Reading values for both mutated and unmutated snails are lowered by an amount that depends on the number of days between the sample being collected and the assay being performed.

Data Dictionary

All of the generated data is stored in a single JSON file called data.json. It can be read and analyzed directly, but it is more realistic to use the data described below.

Persons

persons.csv contains information about the scientists performing the study. The file looks like this:

ident personal family
aa1942 Artur Aasmäe
kk0085 Katrin Kool

and its fields are:

Field Purpose Properties
ident identifier text, unique, required
personal personal name text, required
family family name text, required

Surveys

The surveys directory contains one CSV file for each survey site. Each file's name has the form Snnn.csv (e.g., S165.csv), where Snnn is the survey site's unique identifier. These CSV files do not have column headers; instead, each contains a square integer matrix of pollution readings. A typical file is:

0,0,0,0,0,0,0,0,0,0,0,0,0,0,0
0,0,0,0,0,0,0,0,0,1,1,0,0,0,0
0,0,0,0,0,0,0,0,1,2,1,0,0,0,0
0,0,0,0,0,0,0,0,2,1,0,0,0,0,0
0,0,0,0,0,0,0,1,2,0,0,0,0,0,0
0,0,0,0,0,0,0,1,2,1,0,0,0,0,0
0,0,0,0,0,0,0,0,1,2,0,0,0,0,0
0,0,0,0,0,0,0,2,2,1,0,0,0,0,0
0,0,0,0,0,0,0,1,3,0,0,0,0,0,0
0,0,0,0,0,0,0,1,3,1,0,0,0,0,0
0,0,0,0,0,0,0,0,0,0,0,0,0,0,0
0,0,0,0,0,0,0,0,0,0,0,0,0,0,0
0,0,0,0,0,0,0,0,0,0,0,0,0,0,0
0,0,0,0,0,0,0,0,0,0,0,0,0,0,0
0,0,0,0,0,0,0,0,0,0,0,0,0,0,0

Specimens

specimens.csv holds information about individual snails in CSV format (with column headers). The file looks like this:

ident survey x y collected genome mass
KHNKDL S165 11 4 2024-03-01 GCAACCGGACCGCCGTAAGG 3.82
DZYIPY S165 3 7 2024-03-01 TCATACGGACCGCCGTAAGG 3.53

and its fields are:

Field Purpose Properties
ident specimen identifier text, unique, required
survey survey identifier text, required
x collection X coordinate within survey grid integer, required
y collection Y coordinate within survey grid integer, required
collected collection date ISO date, required
genome base sequence text, required
mass snail weight in grams real, required

Assays

Summary information about all assays is stored in assays.csv. The file looks like this:

ident specimen person performed
386915 KHNKDL km3478 2024-03-05
508199 DZYIPY mt8294 2024-03-01

and its fields are:

Field Purpose Properties
ident assay identifier text, required
specimen specimen identifier text, required
person scientist identifier text, required
performed assay date ISO date, required

The assays directory contains three files for each assay:

  1. a design file nnnnnn_treatments.csv showing whether specimen samples or control material was placed in each well of the assay plate;

  2. a readings file nnnnnn_readings.csv with the reading from each well; and

  3. an image file nnnn.png showing the image that the readings were taken from. (In actuality snailz generates the readings first and then the image.)

Each CSV file contains a multi-line header with metadata followed by a table of well values with row and column labels. A typical design file is:

id,037356,,,
specimen,AMEMRZ,,,
date,2024-03-11,,,
by,pv8677,,,
,A,B,C,D
1,S,C,C,S
2,C,C,S,C
3,S,C,S,S
4,C,S,C,S

while a typical readings file is:

id,037356,,,
specimen,AMEMRZ,,,
date,2024-03-11,,,
by,pv8677,,,
,A,B,C,D
1,1.09,0.08,0.02,1.1
2,0.02,0.02,1.0,0.07
3,1.03,0.03,1.1,1.07
4,0.09,1.02,0.04,1.01

The first four rows of each file are:

Field Purpose Properties
id assay identifier text, required
specimen specimen identifier text, required
date assay date ISO date, required
by scientist identifier text, required

The assays directory also contains a third file for each assay called nnnnnn_raw.csv. Each of these files contains the same data as the assay's readings file, but has some deliberate errors: header rows may be missing or out of order, data may be indented, and so on. These files are provided so that people can learn how to deal with messy real-world data.

Database

All of the data about people, specimens, and assays is also stored in a SQLite database called snailz.db, whose structure is shown below.

database schema

Data File Structure

data
├── params.json
├── data.json
├── persons.csv
├── surveys
│   ├── S165.csv
│   ├── S410.csv
│   └── …
├── specimens.csv
├── assays.csv
├── assays
│   ├── 037356_treatments.csv
│   ├── 037356.png
│   ├── 037356_raw.csv
│   ├── 037356_readings.csv
│   ├── 092025_treatments.csv
│   ├── 092025.png
│   ├── 092025_raw.csv
│   ├── 092025_readings.csv
│   └── …
└── snailz.db

Colophon

snailz was inspired by the Palmer Penguins dataset and by conversations with Rohan Alexander about his book Telling Stories with Data.

The snail logo was created by sunar.ko.

My thanks to everyone who built the tools this project relies on, including:

  • click for building the command-line interface.
  • doit to run commands.
  • mkdocs for documentation.
  • pydantic for storing and validating data (including parameters).
  • pytest, pyfakefs, and faker for testing.
  • ruff and pyright for checking the code.
  • uv for managing packages and the virtual environment.