pYPK0_FBA1tp_ScTAL1_PDC1tp

Step 1 Prepare vector

Linearize pYPKpw with EcoRV resulting in the linearized vector.

Step 2 PCR of first tp

Carry out a PCR with primers 577, 567 and template pYPKa_Z_FBA1tp resulting in the PCR product 861bp_PCR_prod

5GTTCTGATCCTCGAGCATCTTAAGAATTC...CTCACTAGTGACCTGCAGCCGAC3
                                 ||||||||||||||||||||||| tm 59.0 (dbd) 70.7
                                3gagtgatcactggacgtcggcTG5
5gttctgatcctcgagcatcttaagaattc3
 ||||||||||||||||||||||||||||| tm 56.1 (dbd) 69.4
3CAAGACTAGGAGCTCGTAGAATTCTTAAG...GAGTGATCACTGGACGTCGGCTG5


Taq (rate 30 nt/s)
Three-step|         30 cycles     |      |SantaLucia 1998
94.0°C    |94.0°C                 |      |SaltC 50mM
__________|_____          72.0°C  |72.0°C|
04min00s  |30s  \         ________|______|
          |      \ 56.0°C/ 0min25s|10min |
          |       \_____/         |      |
          |         30s           |      |4-8°C

Pfu-Sso7d (rate 15s/kb)
Two-step|    30 cycles |      |Breslauer1986,SantaLucia1998
98.0°C  |98.0C         |      |SaltC 50mM
_____ __|_____         |      |Primer1C 1000µM
00min30s|10s  \  72.0°C|72.0°C|Primer2C <bound method Amplicon.rc of Amplicon(861)>µM
        |      \_______|______|
        |       0min12s|10min |4-8°C

Step 3 Gene PCR

Carry out a PCR with primers 468, 467 and template pYPKa_A_ScTAL1 resulting in the PCR product 1097bp_PCR_prod

5GTCGAGGAACGCCAGGTTGCCCACT...TCTGTGCAGACAAACGCATCAGGAT3
                             ||||||||||||||||||||||||| tm 59.0 (dbd) 73.8
                            3agacacgtctgtttgcgtagtcctaAATTTA5
5gtcgaggaacgccaggttgcccact3
 ||||||||||||||||||||||||| tm 64.8 (dbd) 79.7
3CAGCTCCTTGCGGTCCAACGGGTGA...AGACACGTCTGTTTGCGTAGTCCTA5


Taq (rate 30 nt/s)
Three-step|         30 cycles     |      |SantaLucia 1998
94.0°C    |94.0°C                 |      |SaltC 50mM
__________|_____          72.0°C  |72.0°C|
04min00s  |30s  \         ________|______|
          |      \ 58.0°C/ 0min32s|10min |
          |       \_____/         |      |
          |         30s           |      |4-8°C

Pfu-Sso7d (rate 15s/kb)
Two-step|    30 cycles |      |Breslauer1986,SantaLucia1998
98.0°C  |98.0C         |      |SaltC 50mM
_____ __|_____         |      |Primer1C 1000µM
00min30s|10s  \  72.0°C|72.0°C|Primer2C <bound method Amplicon.rc of Amplicon(1097)>µM
        |      \_______|______|
        |       0min16s|10min |4-8°C

Step 4 PCR of last tp

Carry out a PCR with primers 568, 578 and template pYPKa_E_PDC1tp resulting in the PCR product 1294bp_PCR_prod

5GTGCCATCTGTGCAGACAAACG...ACTTATGAATGTGGCAATGAGACAAGAAC3
                          ||||||||||||||||||||||||||||| tm 56.5 (dbd) 69.5
                         3tgaatacttacaccgttactctgttcttg5
5GTGCcatctgtgcagacaaacg3
 |||||||||||||||||||||| tm 57.1 (dbd) 71.5
3CACGGTAGACACGTCTGTTTGC...TGAATACTTACACCGTTACTCTGTTCTTG5


Taq (rate 30 nt/s)
Three-step|         30 cycles     |      |SantaLucia 1998
94.0°C    |94.0°C                 |      |SaltC 50mM
__________|_____          72.0°C  |72.0°C|
04min00s  |30s  \         ________|______|
          |      \ 55.0°C/ 0min38s|10min |
          |       \_____/         |      |
          |         30s           |      |4-8°C

Pfu-Sso7d (rate 15s/kb)
Two-step|    30 cycles |      |Breslauer1986,SantaLucia1998
98.0°C  |98.0C         |      |SaltC 50mM
_____ __|_____         |      |Primer1C 1000µM
00min30s|10s  \  72.0°C|72.0°C|Primer2C <bound method Amplicon.rc of Amplicon(1294)>µM
        |      \_______|______|
        |       0min19s|10min |4-8°C

Step 5 Yeast transformation

Mix the four linear DNA fragments and transform a Saccharomyces cerevisiae ura3 mutant with the mixture. The fragments will be assembled by in-vivo homologous recombination:

 -|pYPKpw|124
|         \/
|         /\
|         124|861bp_PCR_prod|50
|                            \/
|                            /\
|                            50|1097bp_PCR_prod|37
|                                               \/
|                                               /\
|                                               37|1294bp_PCR_prod|242
|                                                                  \/
|                                                                  /\
|                                                                  242-
|                                                                     |
 ---------------------------------------------------------------------

Step 6 Diagnostic PCR confirmation

First tp and gene

PCR using primers 577 & 467

PCR products (bp)

Correct : 1908
Missing first tp : 1265
Missing gene : 898
Missing both : 255

Gene and last tp

PCR using primers 468 & 578

PCR products (bp)

Correct : 2354
Missing gene : 1344
Missing last tp : 1386
Missing both : 376