stssearch

 

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

Search a DNA database for matches with a set of STS primers

Description

stssearch searches one or more DNA sequences with a set of STS primers and reports expected matches. The database to search, the input primer pairs file and an output file for matches are specified. For each pair of primers, it looks for matches between the primers and the query sequence in either orientation. Details of any matches are written to the output file. Only one primer need match for it to be reported.

Usage

Here is a sample session with stssearch


% stssearch 
Search a DNA database for matches with a set of STS primers
Input nucleotide sequence(s): @eclac.list
Primer pairs file: lac.primers
Output file [j01636.stssearch]: 

Go to the input files for this example
Go to the output files for this example

Command line arguments

Search a DNA database for matches with a set of STS primers
Version: EMBOSS:6.5.6.0

   Standard (Mandatory) qualifiers:
  [-seqall]            seqall     Nucleotide sequence(s) filename and optional
                                  format, or reference (input USA)
  [-infile]            infile     Primer pairs file
  [-outfile]           outfile    [*.stssearch] Output file name

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:

   "-seqall" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -scircular1         boolean    Sequence is circular
   -sformat1           string     Input sequence format
   -iquery1            string     Input query fields or ID list
   -ioffset1           integer    Input start position offset
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outfile" associated qualifiers
   -odirectory3        string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier Type Description Allowed values Default
Standard (Mandatory) qualifiers
[-seqall]
(Parameter 1)
seqall Nucleotide sequence(s) filename and optional format, or reference (input USA) Readable sequence(s) Required
[-infile]
(Parameter 2)
infile Primer pairs file Input file Required
[-outfile]
(Parameter 3)
outfile Output file name Output file <*>.stssearch
Additional (Optional) qualifiers
(none)
Advanced (Unprompted) qualifiers
(none)
Associated qualifiers
"-seqall" associated seqall qualifiers
-sbegin1
-sbegin_seqall
integer Start of each sequence to be used Any integer value 0
-send1
-send_seqall
integer End of each sequence to be used Any integer value 0
-sreverse1
-sreverse_seqall
boolean Reverse (if DNA) Boolean value Yes/No N
-sask1
-sask_seqall
boolean Ask for begin/end/reverse Boolean value Yes/No N
-snucleotide1
-snucleotide_seqall
boolean Sequence is nucleotide Boolean value Yes/No N
-sprotein1
-sprotein_seqall
boolean Sequence is protein Boolean value Yes/No N
-slower1
-slower_seqall
boolean Make lower case Boolean value Yes/No N
-supper1
-supper_seqall
boolean Make upper case Boolean value Yes/No N
-scircular1
-scircular_seqall
boolean Sequence is circular Boolean value Yes/No N
-sformat1
-sformat_seqall
string Input sequence format Any string  
-iquery1
-iquery_seqall
string Input query fields or ID list Any string  
-ioffset1
-ioffset_seqall
integer Input start position offset Any integer value 0
-sdbname1
-sdbname_seqall
string Database name Any string  
-sid1
-sid_seqall
string Entryname Any string  
-ufo1
-ufo_seqall
string UFO features Any string  
-fformat1
-fformat_seqall
string Features format Any string  
-fopenfile1
-fopenfile_seqall
string Features file name Any string  
"-outfile" associated outfile qualifiers
-odirectory3
-odirectory_outfile
string Output directory Any string  
General qualifiers
-auto boolean Turn off prompts Boolean value Yes/No N
-stdout boolean Write first file to standard output Boolean value Yes/No N
-filter boolean Read first file from standard input, write first file to standard output Boolean value Yes/No N
-options boolean Prompt for standard and additional values Boolean value Yes/No N
-debug boolean Write debug output to program.dbg Boolean value Yes/No N
-verbose boolean Report some/full command line options Boolean value Yes/No Y
-help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose Boolean value Yes/No N
-warning boolean Report warnings Boolean value Yes/No Y
-error boolean Report errors Boolean value Yes/No Y
-fatal boolean Report fatal errors Boolean value Yes/No Y
-die boolean Report dying program messages Boolean value Yes/No Y
-version boolean Report version number and exit Boolean value Yes/No N

Input file format

Input files for usage example

File: eclac.list

#Formerly ECLAC
tembl:J01636

#Formerly ECLACA
tembl:X51872

#Formerly ECLACI
tembl:V00294

#Formerly ECLACY
tembl:V00295

#Formerly ECLACZ
tembl:V00296

File: lac.primers

PrimA ACCAGACACCCATCAACAG    TATTTATGCCAGCCAGCCAG
PrimB CGAAAGAATAAGAGCAGGCAAG GTAAGAGAAATAGACAGGCGG
PrimC CGTCAGTATCCCCGTTTACAG  TATCGCCAAAATCACCGCC
PrimD AATACGCAAACCGCCTCTCC   TTATCCGCTCACAATTCCACAC
PrimE AATACGCAAACCGCCTCTCC   CACAACCCGCTCACAATTCCA

The primers file consists of three columns separated by tabs or spaces.

The first column is the name of the primer pair.
The second column is the sequence of the first primer.
The third column is the sequence of the second primer.

Output file format

Output files for usage example

File: j01636.stssearch

J01636: PrimA PrimerA matched at 532
J01636: (rev) PrimA PrimerB matched at 689
J01636: PrimB PrimerA matched at 5743
J01636: (rev) PrimB PrimerB matched at 5942
J01636: PrimC PrimerA matched at 2954
J01636: (rev) PrimC PrimerB matched at 3069
J01636: PrimD PrimerA matched at 1074
J01636: (rev) PrimD PrimerB matched at 1261
J01636: PrimE PrimerA matched at 1074
X51872: PrimB PrimerA matched at 98
X51872: (rev) PrimB PrimerB matched at 297
V00294: PrimA PrimerA matched at 484
V00294: (rev) PrimA PrimerB matched at 641
V00294: PrimD PrimerA matched at 1026
V00294: PrimE PrimerA matched at 1026
V00295: PrimB PrimerA matched at 1439
V00296: PrimC PrimerA matched at 1668
V00296: (rev) PrimC PrimerB matched at 1783

The output file consists of one line per match. This consists of:

Data files

None.

Notes

None.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

None.

Known bugs

None.

See also

Program name Description
eprimer3 Pick PCR primers and hybridization oligos
eprimer32 Pick PCR primers and hybridization oligos
primersearch Search DNA sequences for matches with primer pairs

If you want something that only reports matches of both primer pairs and can find mismatches, use primersearch.

Author(s)

Peter Rice
European Bioinformatics Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK

Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.

History

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None