msbar

 

Wiki

The master copies of EMBOSS documentation are available at http://emboss.open-bio.org/wiki/Appdocs on the EMBOSS Wiki.

Please help by correcting and extending the Wiki pages.

Function

Mutate a sequence

Description

This program changes a sequence, attempting to emulate various forms of mutation. It reads one or more sequences and writes an output file with with a set of (mutated) sequences. The number, size and type of mutation may be specified.

Usage

Here is a sample session with msbar

This asks for 5 mutations, with point mutations as changes (substitutions), and the codon and block mutations ignored.


% msbar 
Mutate a sequence
Input sequence(s): tembl:j01636
Number of times to perform the mutation operations [1]: 5
Point mutation operations
         0 : None
         1 : Any of the following
         2 : Insertions
         3 : Deletions
         4 : Changes
         5 : Duplications
         6 : Moves
Types of point mutations to perform [0]: 4
Block mutation operations
         0 : None
         1 : Any of the following
         2 : Insertions
         3 : Deletions
         4 : Changes
         5 : Duplications
         6 : Moves
Types of block mutations to perform [0]: 
Codon mutation operations
         0 : None
         1 : Any of the following
         2 : Insertions
         3 : Deletions
         4 : Changes
         5 : Duplications
         6 : Moves
Types of codon mutations to perform [0]: 
output sequence(s) [j01636.fasta]: 

Go to the input files for this example
Go to the output files for this example

Command line arguments

Mutate a sequence
Version: EMBOSS:6.5.6.0

   Standard (Mandatory) qualifiers (* if not always prompted):
  [-sequence]          seqall     Sequence(s) filename and optional format, or
                                  reference (input USA)
   -count              integer    [1] Number of times to perform the mutation
                                  operations (Integer 0 or more)
   -point              menu       [0] Types of point mutations to perform
                                  (Values: 0 (None); 1 (Any of the following);
                                  2 (Insertions); 3 (Deletions); 4 (Changes);
                                  5 (Duplications); 6 (Moves))
   -block              menu       [0] Types of block mutations to perform
                                  (Values: 0 (None); 1 (Any of the following);
                                  2 (Insertions); 3 (Deletions); 4 (Changes);
                                  5 (Duplications); 6 (Moves))
*  -codon              menu       [0] Types of codon mutations to perform.
                                  These are only done if the sequence is
                                  nucleic. (Values: 0 (None); 1 (Any of the
                                  following); 2 (Insertions); 3 (Deletions); 4
                                  (Changes); 5 (Duplications); 6 (Moves))
  [-outseq]            seqoutall  [.] Sequence set(s)
                                  filename and optional format (output USA)

   Additional (Optional) qualifiers (* if not always prompted):
*  -inframe            boolean    [N] Do 'codon' and 'block' operations in
                                  frame

   Advanced (Unprompted) qualifiers:
   -othersequence      seqall     [asis:N] If you require that the resulting
                                  mutated sequence should not match a set of
                                  other sequences, then you can specify that
                                  set of sequences here. For example, if you
                                  require that the mutated sequence should not
                                  be the same as the input sequence, enter
                                  the input sequence here. If you want the
                                  result to be different to previous results
                                  of this program, specify the previous result
                                  sequences here. The program will check that
                                  the result does not match the sequences
                                  specified here before writing it out. If a
                                  match is found, then the mutation is started
                                  again with a fresh copy of the input
                                  sequence. If, after 10 such retries, there
                                  is still a match to the set of sequence
                                  given here, then the matching mutated
                                  sequence is written with a warning message.
   -minimum            integer    [1] Minimum size for a block mutation
                                  (Integer 0 or more)
   -maximum            integer    [10] Maximum size for a block mutation (Any
                                  integer value)

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -scircular1         boolean    Sequence is circular
   -sformat1           string     Input sequence format
   -iquery1            string     Input query fields or ID list
   -ioffset1           integer    Input start position offset
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-othersequence" associated qualifiers
   -sbegin             integer    Start of each sequence to be used
   -send               integer    End of each sequence to be used
   -sreverse           boolean    Reverse (if DNA)
   -sask               boolean    Ask for begin/end/reverse
   -snucleotide        boolean    Sequence is nucleotide
   -sprotein           boolean    Sequence is protein
   -slower             boolean    Make lower case
   -supper             boolean    Make upper case
   -scircular          boolean    Sequence is circular
   -sformat            string     Input sequence format
   -iquery             string     Input query fields or ID list
   -ioffset            integer    Input start position offset
   -sdbname            string     Database name
   -sid                string     Entryname
   -ufo                string     UFO features
   -fformat            string     Features format
   -fopenfile          string     Features file name

   "-outseq" associated qualifiers
   -osformat2          string     Output seq format
   -osextension2       string     File name extension
   -osname2            string     Base file name
   -osdirectory2       string     Output directory
   -osdbname2          string     Database name to add
   -ossingle2          boolean    Separate file for each entry
   -oufo2              string     UFO features
   -offormat2          string     Features format
   -ofname2            string     Features file name
   -ofdirectory2       string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write first file to standard output
   -filter             boolean    Read first file from standard input, write
                                  first file to standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options and exit. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages
   -version            boolean    Report version number and exit

Qualifier Type Description Allowed values Default
Standard (Mandatory) qualifiers
[-sequence]
(Parameter 1)
seqall Sequence(s) filename and optional format, or reference (input USA) Readable sequence(s) Required
-count integer Number of times to perform the mutation operations Integer 0 or more 1
-point list Types of point mutations to perform
0 (None)
1 (Any of the following)
2 (Insertions)
3 (Deletions)
4 (Changes)
5 (Duplications)
6 (Moves)
0
-block list Types of block mutations to perform
0 (None)
1 (Any of the following)
2 (Insertions)
3 (Deletions)
4 (Changes)
5 (Duplications)
6 (Moves)
0
-codon list Types of codon mutations to perform. These are only done if the sequence is nucleic.
0 (None)
1 (Any of the following)
2 (Insertions)
3 (Deletions)
4 (Changes)
5 (Duplications)
6 (Moves)
0
[-outseq]
(Parameter 2)
seqoutall Sequence set(s) filename and optional format (output USA) Writeable sequence(s) <*>.format
Additional (Optional) qualifiers
-inframe boolean Do 'codon' and 'block' operations in frame Boolean value Yes/No No
Advanced (Unprompted) qualifiers
-othersequence seqall If you require that the resulting mutated sequence should not match a set of other sequences, then you can specify that set of sequences here. For example, if you require that the mutated sequence should not be the same as the input sequence, enter the input sequence here. If you want the result to be different to previous results of this program, specify the previous result sequences here. The program will check that the result does not match the sequences specified here before writing it out. If a match is found, then the mutation is started again with a fresh copy of the input sequence. If, after 10 such retries, there is still a match to the set of sequence given here, then the matching mutated sequence is written with a warning message. Readable sequence(s) asis:N
-minimum integer Minimum size for a block mutation Integer 0 or more 1
-maximum integer Maximum size for a block mutation Any integer value 10
Associated qualifiers
"-sequence" associated seqall qualifiers
-sbegin1
-sbegin_sequence
integer Start of each sequence to be used Any integer value 0
-send1
-send_sequence
integer End of each sequence to be used Any integer value 0
-sreverse1
-sreverse_sequence
boolean Reverse (if DNA) Boolean value Yes/No N
-sask1
-sask_sequence
boolean Ask for begin/end/reverse Boolean value Yes/No N
-snucleotide1
-snucleotide_sequence
boolean Sequence is nucleotide Boolean value Yes/No N
-sprotein1
-sprotein_sequence
boolean Sequence is protein Boolean value Yes/No N
-slower1
-slower_sequence
boolean Make lower case Boolean value Yes/No N
-supper1
-supper_sequence
boolean Make upper case Boolean value Yes/No N
-scircular1
-scircular_sequence
boolean Sequence is circular Boolean value Yes/No N
-sformat1
-sformat_sequence
string Input sequence format Any string  
-iquery1
-iquery_sequence
string Input query fields or ID list Any string  
-ioffset1
-ioffset_sequence
integer Input start position offset Any integer value 0
-sdbname1
-sdbname_sequence
string Database name Any string  
-sid1
-sid_sequence
string Entryname Any string  
-ufo1
-ufo_sequence
string UFO features Any string  
-fformat1
-fformat_sequence
string Features format Any string  
-fopenfile1
-fopenfile_sequence
string Features file name Any string  
"-othersequence" associated seqall qualifiers
-sbegin integer Start of each sequence to be used Any integer value 0
-send integer End of each sequence to be used Any integer value 0
-sreverse boolean Reverse (if DNA) Boolean value Yes/No N
-sask boolean Ask for begin/end/reverse Boolean value Yes/No N
-snucleotide boolean Sequence is nucleotide Boolean value Yes/No N
-sprotein boolean Sequence is protein Boolean value Yes/No N
-slower boolean Make lower case Boolean value Yes/No N
-supper boolean Make upper case Boolean value Yes/No N
-scircular boolean Sequence is circular Boolean value Yes/No N
-sformat string Input sequence format Any string  
-iquery string Input query fields or ID list Any string  
-ioffset integer Input start position offset Any integer value 0
-sdbname string Database name Any string  
-sid string Entryname Any string  
-ufo string UFO features Any string  
-fformat string Features format Any string  
-fopenfile string Features file name Any string  
"-outseq" associated seqoutall qualifiers
-osformat2
-osformat_outseq
string Output seq format Any string  
-osextension2
-osextension_outseq
string File name extension Any string  
-osname2
-osname_outseq
string Base file name Any string  
-osdirectory2
-osdirectory_outseq
string Output directory Any string  
-osdbname2
-osdbname_outseq
string Database name to add Any string  
-ossingle2
-ossingle_outseq
boolean Separate file for each entry Boolean value Yes/No N
-oufo2
-oufo_outseq
string UFO features Any string  
-offormat2
-offormat_outseq
string Features format Any string  
-ofname2
-ofname_outseq
string Features file name Any string  
-ofdirectory2
-ofdirectory_outseq
string Output directory Any string  
General qualifiers
-auto boolean Turn off prompts Boolean value Yes/No N
-stdout boolean Write first file to standard output Boolean value Yes/No N
-filter boolean Read first file from standard input, write first file to standard output Boolean value Yes/No N
-options boolean Prompt for standard and additional values Boolean value Yes/No N
-debug boolean Write debug output to program.dbg Boolean value Yes/No N
-verbose boolean Report some/full command line options Boolean value Yes/No Y
-help boolean Report command line options and exit. More information on associated and general qualifiers can be found with -help -verbose Boolean value Yes/No N
-warning boolean Report warnings Boolean value Yes/No Y
-error boolean Report errors Boolean value Yes/No Y
-fatal boolean Report fatal errors Boolean value Yes/No Y
-die boolean Report dying program messages Boolean value Yes/No Y
-version boolean Report version number and exit Boolean value Yes/No N

Input file format

msbar reads one or more nucleotide or protein sequences.

The input is a standard EMBOSS sequence query (also known as a 'USA').

Major sequence database sources defined as standard in EMBOSS installations include srs:embl, srs:uniprot and ensembl

Data can also be read from sequence output in any supported format written by an EMBOSS or third-party application.

The input format can be specified by using the command-line qualifier -sformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: gff (gff3), gff2, embl (em), genbank (gb, refseq), ddbj, refseqp, pir (nbrf), swissprot (swiss, sw), dasgff and debug.

See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats.

Input files for usage example

'tembl:j01636' is a sequence entry in the example nucleic acid database 'tembl'

Database entry: tembl:j01636

ID   J01636; SV 1; linear; genomic DNA; STD; PRO; 7477 BP.
XX
AC   J01636; J01637; K01483; K01793;
XX
DT   30-NOV-1990 (Rel. 26, Created)
DT   09-SEP-2004 (Rel. 81, Last updated, Version 8)
XX
DE   E.coli lactose operon with lacI, lacZ, lacY and lacA genes.
XX
KW   acetyltransferase; beta-D-galactosidase; galactosidase; lac operon;
KW   lac repressor protein; lacA gene; lacI gene; lactose permease; lacY gene;
KW   lacZ gene; mutagenesis; palindrome; promoter region;
KW   thiogalactoside acetyltransferase.
XX
OS   Escherichia coli
OC   Bacteria; Proteobacteria; Gammaproteobacteria; Enterobacteriales;
OC   Enterobacteriaceae; Escherichia.
XX
RN   [1]
RP   1243-1266
RX   DOI; 10.1073/pnas.70.12.3581.
RX   PUBMED; 4587255.
RA   Gilbert W., Maxam A.;
RT   "The nucleotide sequence of the lac operator";
RL   Proc. Natl. Acad. Sci. U.S.A. 70(12):3581-3584(1973).
XX
RN   [2]
RP   1246-1308
RX   DOI; 10.1073/pnas.70.12.3585.
RX   PUBMED; 4587256.
RA   Maizels N.M.;
RT   "The nucleotide sequence of the lactose messenger ribonucleic acid
RT   transcribed from the UV5 promoter mutant of Escherichia coli";
RL   Proc. Natl. Acad. Sci. U.S.A. 70(12):3585-3589(1973).
XX
RN   [3]
RX   PUBMED; 4598642.
RA   Gilbert W., Maizels N., Maxam A.;
RT   "Sequences of controlling regions of the lactose operon";
RL   Cold Spring Harb. Symp. Quant. Biol. 38:845-855(1974).
XX
RN   [4]
RA   Gilbert W., Gralla J., Majors A.J., Maxam A.;
RT   "Lactose operator sequences and the action of lac repressor";
RL   (in) Sund H., Blauer G. (Eds.);
RL   PROTEIN-LIGAND INTERACTIONS:193-207;
RL   Walter de Gruyter, New York (1975)
XX
RN   [5]
RP   1146-1282


  [Part of this file has been deleted for brevity]

     cgatttggct acatgacatc aaccatatca gcaaaagtga tacgggtatt atttttgccg      4560
     ctatttctct gttctcgcta ttattccaac cgctgtttgg tctgctttct gacaaactcg      4620
     ggctgcgcaa atacctgctg tggattatta ccggcatgtt agtgatgttt gcgccgttct      4680
     ttatttttat cttcgggcca ctgttacaat acaacatttt agtaggatcg attgttggtg      4740
     gtatttatct aggcttttgt tttaacgccg gtgcgccagc agtagaggca tttattgaga      4800
     aagtcagccg tcgcagtaat ttcgaatttg gtcgcgcgcg gatgtttggc tgtgttggct      4860
     gggcgctgtg tgcctcgatt gtcggcatca tgttcaccat caataatcag tttgttttct      4920
     ggctgggctc tggctgtgca ctcatcctcg ccgttttact ctttttcgcc aaaacggatg      4980
     cgccctcttc tgccacggtt gccaatgcgg taggtgccaa ccattcggca tttagcctta      5040
     agctggcact ggaactgttc agacagccaa aactgtggtt tttgtcactg tatgttattg      5100
     gcgtttcctg cacctacgat gtttttgacc aacagtttgc taatttcttt acttcgttct      5160
     ttgctaccgg tgaacagggt acgcgggtat ttggctacgt aacgacaatg ggcgaattac      5220
     ttaacgcctc gattatgttc tttgcgccac tgatcattaa tcgcatcggt gggaaaaacg      5280
     ccctgctgct ggctggcact attatgtctg tacgtattat tggctcatcg ttcgccacct      5340
     cagcgctgga agtggttatt ctgaaaacgc tgcatatgtt tgaagtaccg ttcctgctgg      5400
     tgggctgctt taaatatatt accagccagt ttgaagtgcg tttttcagcg acgatttatc      5460
     tggtctgttt ctgcttcttt aagcaactgg cgatgatttt tatgtctgta ctggcgggca      5520
     atatgtatga aagcatcggt ttccagggcg cttatctggt gctgggtctg gtggcgctgg      5580
     gcttcacctt aatttccgtg ttcacgctta gcggccccgg cccgctttcc ctgctgcgtc      5640
     gtcaggtgaa tgaagtcgct taagcaatca atgtcggatg cggcgcgacg cttatccgac      5700
     caacatatca taacggagtg atcgcattga acatgccaat gaccgaaaga ataagagcag      5760
     gcaagctatt taccgatatg tgcgaaggct taccggaaaa aagacttcgt gggaaaacgt      5820
     taatgtatga gtttaatcac tcgcatccat cagaagttga aaaaagagaa agcctgatta      5880
     aagaaatgtt tgccacggta ggggaaaacg cctgggtaga accgcctgtc tatttctctt      5940
     acggttccaa catccatata ggccgcaatt tttatgcaaa tttcaattta accattgtcg      6000
     atgactacac ggtaacaatc ggtgataacg tactgattgc acccaacgtt actctttccg      6060
     ttacgggaca ccctgtacac catgaattga gaaaaaacgg cgagatgtac tcttttccga      6120
     taacgattgg caataacgtc tggatcggaa gtcatgtggt tattaatcca ggcgtcacca      6180
     tcggggataa ttctgttatt ggcgcgggta gtatcgtcac aaaagacatt ccaccaaacg      6240
     tcgtggcggc tggcgttcct tgtcgggtta ttcgcgaaat aaacgaccgg gataagcact      6300
     attatttcaa agattataaa gttgaatcgt cagtttaaat tataaaaatt gcctgatacg      6360
     ctgcgcttat caggcctaca agttcagcga tctacattag ccgcatccgg catgaacaaa      6420
     gcgcaggaac aagcgtcgca tcatgcctct ttgacccaca gctgcggaaa acgtactggt      6480
     gcaaaacgca gggttatgat catcagccca acgacgcaca gcgcatgaaa tgcccagtcc      6540
     atcaggtaat tgccgctgat actacgcagc acgccagaaa accacggggc aagcccggcg      6600
     atgataaaac cgattccctg cataaacgcc accagcttgc cagcaatagc cggttgcaca      6660
     gagtgatcga gcgccagcag caaacagagc ggaaacgcgc cgcccagacc taacccacac      6720
     accatcgccc acaataccgg caattgcatc ggcagccaga taaagccgca gaaccccacc      6780
     agttgtaaca ccagcgccag cattaacagt ttgcgccgat cctgatggcg agccatagca      6840
     ggcatcagca aagctcctgc ggcttgccca agcgtcatca atgccagtaa ggaaccgctg      6900
     tactgcgcgc tggcaccaat ctcaatatag aaagcgggta accaggcaat caggctggcg      6960
     taaccgccgt taatcagacc gaagtaaaca cccagcgtcc acgcgcgggg agtgaatacc      7020
     acgcgaaccg gagtggttgt tgtcttgtgg gaagaggcga cctcgcgggc gctttgccac      7080
     caccaggcaa agagcgcaac aacggcaggc agcgccacca ggcgagtgtt tgataccagg      7140
     tttcgctatg ttgaactaac cagggcgtta tggcggcacc aagcccaccg ccgcccatca      7200
     gagccgcgga ccacagcccc atcaccagtg gcgtgcgctg ctgaaaccgc cgtttaatca      7260
     ccgaagcatc accgcctgaa tgatgccgat ccccacccca ccaagcagtg cgctgctaag      7320
     cagcagcgca ctttgcgggt aaagctcacg catcaatgca ccgacggcaa tcagcaacag      7380
     actgatggcg acactgcgac gttcgctgac atgctgatga agccagcttc cggccagcgc      7440
     cagcccgccc atggtaacca ccggcagagc ggtcgac                               7477
//

Output file format

The output is a standard EMBOSS sequence file.

The results can be output in one of several styles by using the command-line qualifier -osformat xxx, where 'xxx' is replaced by the name of the required format. The available format names are: embl, genbank, gff, pir, swiss, dasgff, debug, listfile, dbmotif, diffseq, excel, feattable, motif, nametable, regions, seqtable, simple, srs, table, tagseq.

See: http://emboss.sf.net/docs/themes/SequenceFormats.html for further information on sequence formats.

Output files for usage example

File: j01636.fasta

>J01636 J01636.1 E.coli lactose operon with lacI, lacZ, lacY and lacA genes.
gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgcccggaagagagt
caattcagggtggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggt
gtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacg
cgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaa
caactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcac
gcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtg
gtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatctt
ctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccatt
gctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagaca
cccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctg
gtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcg
cgtctgcgtctggctggctggcataaatTtctcactcgcaatcaaattcagccgatagcg
gaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaat
gagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatg
cgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgac
gataccgaagacagctcatgttatatcccgccgtcaaccaccatcaaacaggattttcgc
ctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaag
ggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacg
caaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcc
cgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggc
accccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggata
acaatttcacacaggaaacagctatgaccatgattacggattcactggccgtcgttttac
aacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatcccc
ctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgc
gcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaa
gctggctggagtgcgatcttcctgaggccgatactgtcgtcgtcccctcaaactggcaga
tgcacggttacgatgcgcccatctacaccaacgtaacctatcccattacggtcaatccgc
cgtttgttcccacggagaatccgacgggttgttactcgctcacatttaatgttgatgaaa
gctggctacaggaaggccagacgcgaattatttttgatggcgttaactcggcgtttcatc
tgtggtgcaacgggcgctgggtcggttacggccaggacagtcgtttgccgtctgaatttg
acctgagcgcatttttacgcgccggagaaaaccgcctcgcggtgatggtgctgcgttgga
gtgacggcagttatctggaagatcaggatatgtggcggatgagcggcattttccgtgacg
tctcgttgctgcataaaccgactacacaaatcagcgatttccatgttgccactcgcttta
atgatgatttcagccgcgctgtactggaggctgaagttcagatgtgcggcgagttgcgtg
actacctacgggtaacagtttctttatggcagggtgaaacgcaggtcgccagcggcaccg
cgcctttcggcggtgaaattatcgatgagcgtggtggttatgccgatcgcgtcacactac
gtctgaacgtcgaaaacccgaaactgtggagcgccgaaatcccgaatctctatcgtgcgg
tggttgaactgcacaccgccgacggcacgctgattgaagcagaagcctgcgatgtcggtt
tccgcgaggtgcggattgaaaatggtctgctgctgctgaacggcaagccgttgctgattc
gaggcgttaaccgtcacgagcatcatcctctgcatggtcaggtcatggatgagcagacga
tggtgcaggatatcctgctgatgaagcagaacaactttaacgccgtgcgctgttcgcatt
atccgaaccatccgctgtggtacacgctgtgcgaccgctacggcctgtatgtggtggatg
aagccaatattgaaacccacggcatggtgccaatgaatcgtctgaccgatgatccgcgct
ggctaccggcgatgagcgaacgcgtaacgcgaatggtgcagcgcgatcgtaatcacccga
gtgtgatcatctggtcgctggggaatgaatcaggccacggcgctaatcacgacgcgctgt
atcgctggatcaaatctgtcgatccttcccgcccggtgcagtatgaaggcggcggagccg
acaccacggccaccgatattatttgcccgatgtacgcgcgcgtggatgaagaccagccct
tcccggctgtgccgaaatggtccatcaaaaaatggctttcgctacctggagagacgcgcc
cgctgatcctttgcgaatacgcccacgcgatgggtaacagtcttggcggtttcgctaaat


  [Part of this file has been deleted for brevity]

tgttcggtttattctttttcttttacttttttatcatgggagcctacttcccgtttttcc
cgatttggctacatgacatcaaccatatcagcaaaagtgatacgggtattatttttgccg
ctatttctctgttctcgctattattccaaccgctgtttggtctgctttctgacaaactcg
ggctgcgcaaatacctgctgtggattattaccggcatgttagtgatgtttgcgccgttct
ttatttttatcttcgggccactgttacaatacaacattttagtaggatcgattgttggtg
gtatttatctaggcttttgttttaacgccggtgcgccagcagtagaggcatttattgaga
aagtcagccgtcgcagtaatttcgaatttggtcgcgcgcggatgtttggctgtgttggct
gggcgctgtgtgccTcgattgtcggcatcatgttcaccatcaataatcagtttgttttct
ggctgggctctggctgtgcactcatcctcgccgttttactctttttcgccaaaacggatg
cgccctcttctgccacggttgccaatgcggtaggtgccaaccattcggcatttagcctta
agctggcactggaactgttcagacagccaaaactgtggtttttgtcactgtatgttattg
gcgtttcctgcacctacgatgtttttgaccaacagtttgctaatttctttacttcgttct
ttgctaccggtgaacagggtacgcgggtatttggctacgtaacgacaatgggcgaattac
ttaacgcctcgattatgttctttgcgccactgatcattaatcgcatcggtgggaaaaacg
ccctgctgctggctggcactattatgtctgtacgtattattggctcatcgttcgccacct
cagcgctggaagtggttattctgaaaacgctgcatatgtttgaagtaccgttcctgctgg
tgggctgctttaaatatattaccagccagtttgaagtgcgtttttcagcgacgatttatc
tggtctgtttctgcttctttaagcaactggcgatgatttttatgtctgtactggcgggca
atatgtatgaaagcatcggtttccagggcgcttatctggtgctgggtctggtggcgctgg
gcttcaccttaatttccgtgttcacgcttagcggccccggcccgctttccctgctgcgtc
gtcaggtgaatgaagtcgcttaagcaatcaatgtcggatgcggcgcgacgcttatccgac
caacatatcataacggagtgatcgcattgaacatgccaatgaccgaaagaataagagcag
gcaagctatttaccgatatgtgcgaaggcttaccggaaaaaagacttcgtgggaaaacgt
taatgtatgagtCtaatcactcgcatccatcagaagttgaaaaaagagaaagcctgatta
aagaaatgtttgccacggtaggggaaaacgcctgggCagaaccgcctgtctatttctctt
acggttccaacatccatataggccgcaatttttatgcaaatttcaatttaaccattgtcg
atgactacacggtaacaatcggtgataacgtactgattgcacccaacgttactctttccg
ttacgggacaccctgtacaccatgaattgagaaaaaacggcgagatgtactcttttccga
taacgattggcaataacgtctggatcggaagtcatgtggttattaatccaggcgtcacca
tcggggataattctgttattggcgcgggtagtatcgtcacaaaagacattccaccaaacg
tcgtggcggctggcgttccttgtcgggttattcgcgaaataaacgaccgggataagcact
attatttcaaagattataaagttgaatcgtcagtttaaattataaaaattgcctgatacg
ctgcgcttatcaggcctacaagttcagcgatctacattagccgcatccggcatgaacaaa
gcgcaggaacaagcgtcgcatcatgcctctttgacccacagctgcggaaaacgtactggt
gcaaaacgcagggttatgatcatcagcccaacgacgcacagcgcatgaaatgcccagtcc
atcaggtaattgccgctgatactacgcagcacgccagaaaaccacggggcaagcccggcg
atgataaaaccgattccctgcataaacgccaccagcttgccagcaatagccggttgcaca
gagtgatcgagcgccagcagcaaacagagcggaaacgcgccgcccagacctaacccacac
accatcgcccacaataccggcaattgcatcggcagccagataaagccgcagaaccccacc
agttgtaacaccagcgccagcattaacagtttgcgccgatcctgatggcgagccatagca
ggcatcagcaaagctcctgcggcttgcccaagcgtcatcaatgccagtaaggaaccgctg
tactgcgcgctggcaccaatctcaatatagaaagcgggtaaccaggcaatcaggctggcg
taaccgccgttaatcagaccgaagtaaacacccagcgtccacgcgcggggagtgaatacc
acgcgaaccggagtggttgttgtcttgtgggaagaggcgacctcgcgggcgctttgccac
caccaggcaaagagcgcaacaacggcaggcagcgccaccaggcgagtgtttgataccagg
tttcgctatgttgaactaaccagggcgttatggcggcaccaagcccaccgccgcccatca
gagccgcggaccacagccccatcaccagtggcgtgcgctgctgaaaccgccgtttaatca
ccgaagcatcaccgcctgaatgatgccgatccccaccccaccaagcagtgcgctgctaag
cagcagcgcactttgcgggtaaagctcacgcatcaatgcaccgacggcaatcagcaacag
actgatggcgacactgcgacgttcgctgacatgctgatgaagccagcttccggccagcgc
cagcccgcccatggtaaccaccggcagagcggtcgac

The output is a sequence file with 5 substitutions relative to the original sequence.

Data files

None.

Notes

The qualifiers allow the number, size and type of mutation to be controlled.

The "size" of mutation may be set as following:

If the sequence is nucleic, the codon and block-sized operations can optionally be done in-frame. This causes the minimum block size to be set to 3 and the randomly chosen positions to be multiples of 3.

For each of the above size of sequence it can produce the effects of any of the following types of mutation at a randomly chosen position:

The input and output sequences may not differ if only a few changes are chosen as (for example) one in four nucleic acid point substitutions will not change the sequence.

There is no selection of the types of mutation to produce viable sequence as there would be in a real organism. In particular, there is no attempt to bias mutations of nucleic acid sequences to conform to the C+G ratio in the sequence or to bias the codons in the direction of the frequencies used in the organism. This program emulates mutation, not selection.

This program was named from the acronym of "Mutate Sequence Beyond All Recognition", by analogy with the acronym "fubar" commonly used in the US and UK armed forces.

If you require the mutated sequences to not match some other set of sequences, this set may be specified with the -othersequence qualifier. For example, the mutants should not match the input sequence, or the results of a previous run of this program. msbar ensures the mutants do not match the specified sequences. If a match is found, then the mutation is started again with a fresh copy of the input sequence. If, after 10 such retries, there is still a match to the set of sequence given here, then the matching mutated sequence is written with a warning message.

References

None.

Warnings

None.

Diagnostic Error Messages

None.

Exit status

It always exits with a status of 0.

Known bugs

None.

See also

Program name Description
shuffleseq Shuffle a set of sequences maintaining composition

Author(s)

Gary Williams formerly at:
MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust Genome Campus, Hinxton, Cambridge, CB10 1SB, UK

Please report all bugs to the EMBOSS bug team (emboss-bug © emboss.open-bio.org) not to the original author.

History

Written (1999) - Gary Williams

Target users

This program is intended to be used by everyone and everything, from naive users to embedded scripts.

Comments

None